Chromas Activation Key PC/Windows Chromas is a simple, but effective and powerful tool for chromatography data analysis. It is based on the standard histogram. Chromas can read a lot of popular chromatographic formats (e.g. AVI, ESD, SCF, AB1, RSD). It's a bit like Paint for chromatograms. Chromas provides a lot of features to enhance the analysis of chromatography data. The most useful feature is that it can visualize chromatographic peaks and eliminate them to save space. There are a number of parameters, such as showing or not the baseline, setting height or width of peaks and trimming short peaks. There are various ways to set the default parameters. Chromas can also view and analyze NGS data, which has not been possible before. Chromas can be used on both Windows and Mac. It uses a small amount of resources. Chromas is very simple to use and user friendly. There are 5 buttons to view the user interface: File/Open Channels Peak View Export Chromas has several types of output: PDF, SVG, PNG, JPG, HTML Chromas Additional Features: There is an option to view and manage toolbars. Chromas can use the Wine version of Virtualbox to run as a portable application. Chromas has been tested on different operating systems: Windows 7, 8, 10, macOS Sierra. You can also run Chromas on a Mac OS. Chromas has a very simple interface, but still a lot of features. The main page includes 3 tabs: File Channels Peak To use the program, you can select the file to open. The most commonly used file types include ESD, SCF, AVI, AB1, RSD and NGS. The Channels tab has 3 sections: List channels Configure colors Trim The channels are presented in a list. You can adjust the color, display width of peaks, trim, and so on. The Peak tab has a window with 4 sections: View Set Set default parameters Export When you are viewing the chromatogram, a little thumbnail is displayed at the top right corner. You can click on it to view the actual data. The View section has a drop-down menu to show or hide different types of information. The setting is not saved in the Registry. If you want Chromas 8e68912320 Chromas [Win/Mac] ========================= AcroQC - automatic comparison of sequences Chromas - chromatogram viewer COREF: 738123668 CHROMATOGRAMS: ========================= Examples: ----------- Go to the sequence directory: cd Chromas All sequences in that directory: ls Chromatograms for the sequence gaacatttagggaagcattgaaa: Chromatograms for the sequence tttcctgtgggtcttcagtgtctttcag: Chromatograms for the sequence tcacacaaacgagtatttcctacacacaa: Chromatograms for the sequence cgcgatcgatgtgcgtcggtgtcgatcgat: Chromatograms for the sequence ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt What's New In? System Requirements For Chromas: OS: Windows 7, 8, 8.1, 10 Processor: Intel Core 2 Duo 2.2 GHz or equivalent Memory: 1 GB RAM Hard Disk: 15 GB available space Recommended System Requirements: Processor: Intel Core i3 2.2 GHz or equivalent Playlist Requirements: Requires 4GB+ of RAM Windows 7 or later
Related links:
Comments